THE HISTORY OF A COLLABORATION BETWEEN WORDS AND MUSIC WITH SCIENCE AT THE BACK OF BOTH
My brief was to write a poem, commissioned by the Wellcome Trust, for a twenty minute, forty part a capella choral piece on “the positive aspects of genetics unconnected with disease”. It should somehow be about “the relation between genes and music, the human genome, and the attempt to discover whether a specific gene influences musical ability.” Uniquely, the music - which must, I thought, have some relation to Tallis’s Spem in Alium which I sang long ago with the Schola Cantorum of Oxford - would incorporate the choir’s DNA.
I hadn’t met yet met the composer. We began emailing each other just before the summer holiday. He was going away and Andrew Morley had given him a student book on genes. “I still have very loose ideas,” Michael Zev Gordon emailed me, “though the science will toughen them up I guess.”
He was thinking of a piece in 5 parts, moving from 2 to 5 to 10 to 20 to 40 voices. “Something about 'doubling' and splitting and growing in complexity,” he said, “DNA replication enzymes copy amino acid sequences. They split in half. Everything is in pairs.” He was going to work into the music the difference between sequences in the genome that are common to everyone, and tiny changes that might express a tendency towards 'musicality'. So he was working with repetition and tiny variation. “I want to turn into notes in the tradition of 'BACH', the four letters they use to describe the proteins.”
None of this helped with the actual words. I asked Andrew Morley what he wanted the words to say.“Up to you and Michael unless you need me to explain anything about gene sequences. It would be good to have something to do with genetics in the broadest sense. Variety of life, mysteries of the cell, all different but all the same.”
I had no idea where this was going. “Anything really,” Andrew added. “Or see if the sequences lead you anywhere. Michael will be doing this with the music. There will be 17 stretches of 101 letters (each stretch associated with one polymorphism or genetic difference) with a crucial point somewhere in the middle. The sequences consist entirely of the letters T,A,C,G:
CCCGGGTTAAATATATGGTTAAGGTTAAGTTTTAAAGTGTGTCCCTTTGA
GGGTATATTTTCTCTGAGATCTCGAGTAGTAGCCCCGGTTT for example.”
I couldn’t get my head round this. My daughter got out her A level Biology notes and sat me down at the kitchen table to explain genes. All that summer I read genetics. I was supposed to be finishing The Mara Crossing, a book of poems and prose on migration, animal and human. I had been writing this for five years but it kept being interrupted by other more urgent books, like Darwin - A Life in Poems for the Darwin bicentenary or my novel Where the Serpent Lives. Now migration was being interrupted again by genes, cells, genomes and DNA.
But I found my migration project massively enriched by the science. I learned that cells “migrate” in our bodies to heal (the immune system depends on cell migration) and to create - cells migrate from other places in a mother’s body to make a foetus. From my daughter’s biology notes I went on to explore the processes of cell growth and multiplication and began to see the development of a cell, and its splitting, as a kind of soap opera. The drama was in the relationships, interventions and developments of minute substances inside the tiny theatre of a single cell.
I wrote a poem called “First Cell”, which is now the first poem in The Mara Crossing, whose subject is now, thanks to the genome project, migration from cells to souls, taking in birds, mammals, insects, marine life and human en route. I wrote a sequence of poems about cells, DNA, splitting, spreading and pair. I also learned about alleles. I liked the sound and roots of the word as well as the idea. The word comes from greek allelos, meaning “each other”, and is related to allos, other. Cells, I was beginning to realize, are all about self and other. And an allele was what people meant when they loosely said there was “a gene for” some trait. Allele was the variant, the Other.
Each human cell, I learned, has two copies of each gene. They often differ from each other in having a slightly different order of genetic letters. Each copy is an allele. New ones are created through mutation. Doubleness, alternativeness, was a vital to the whole business of cells.
By August’s end I had a sequence of 23 poems and asked Andrew to check the science. For a composer, the shorter the text the better. Michael would need something very economical but I sent him the lot in case one struck him he could work with. He loved them but couldn’t find one single poem which would, as he put it, “complement the music I will write:” music which had to be embedded in a specific experiment looking for tiny differences, which might suggest musicality, in the base sequence.
“NOT”, he said, “that we need a text about the experiment itself. It could be far more abstracted. Perhaps the issue is that all these poems are so precisely focussed, but not on that thing of tiny differences, that they don't quite give me the 'hold' I think I still need.” He saw possibilities in three. One about Nucleic Acid had, he felt, “a certain kind of poetic imagery and - don't know how to put it - a kind of 'concentration' that for me does 'let the music in'.” But he found it too precise about one stage of cell development, the way the different strands of DNA fit together and replicate. He loved another about daughter cells but felt it wouldn’t work with choral music, “which somehow demands something less 'personal' to convince, I believe.”
I was learning a lot about how composers react to a text. Michael felt my poem about alleles, though, had more mileage. His own association to the word (which was new to him too, I was glad to hear) was with Tallis’s Spem in Alium. He felt this poem got closest to that key idea of difference but he needed it, he said, to “evoke” more. Whatever it was he wanted, which neither he nor I yet knew, was something he thought of as more “abstract”. For me, it looked as if wanted something more imagistic.
“I'm so sorry to be difficult,” he wrote. He wondered if instead of using a single poem for the whole piece he could use different poems or ideas for different sections of the music. Would I mind if he lifted lines out of different poems? “I would love the thing to start with the line 'as if from outer space' and end 'for the stranger might also be god'.”
I recognized that feeling. The words had to open doors for him, give him space to do his own melodic, structural and harmonic imagining. I realized I didn’t have to think of what I gave him as a poem. My experience of working with composers was that at some point the text provider has to offer words then back right away. I had my 23 poems, I was happy with them, the process had already been enormously productive for me. Now I had to use poetry’s kitbox, the tools of cohesion, harmony, rhyme, metre, cadence and above all (it seemed, given Michael's responses) metaphor, to make something which would both inspire him and suggest shape.
When Michael came round, the first time we met, I could hardly speak. I’d been doing too many poetry readings and was having trouble with my voice. A voice specialist had advised me to “steam” my throat. Then I’d gone out to sing madrigals, the very worst thing I could have done. This didn’t seem a great omen for a choral work.
We spread the poems over the kitchen table. Michael spoke again about “abstraction” which I interpreted as “images”. Croakily, I read him a sonnet called “Tiger Drinking at Forest Pool” which I had written with George Herbert’s beautiful poem “Prayer” at the back of my mind. Both poems are a sequence of images for the thing they are “about”. A tiger, in my case. Prayer, for Herbert. Would Michael like something on those lines - a series of images for what the science was about, those tiny differences in a sequence? Yes. He’d like something “similar in feel” to that.
It was now mid September. I thought of the “otherness” I associated with alleles. “Allele comes from allelos meaning "each other"” I wrote to him. “It relates to the fact that genes come in pairs. I suspect that pairings are going to be important.” I wrote him a sonnet in equal halves, 7 and 7, because genes come in pairs. I added the numbers of syllables in each line in each half, in case that was useful and called it Strangers and Others. I had no idea we were going to go through seven more drafts over two months to arrive at what we were both happy with.
DRAFT I STRANGERS AND OTHERS 16/9/09
Bright vagrant, mystic variant, lightning rod,
the Copy. Secret scripture, written on red sky
by wheeling birds. Allelic mysteries of cell,
all different, all the same. Mutations tell
of Chinese whispers in the labyrinth,
the ghost that walks the body, love which stirs
the sun and other stars in Dante’s universe.
Shadow in the mirror of the self; the Other
who reveals the exit wound; the hare still in its form,
leaving its imprint behind. A barcode, occult
as Kabbalah, invisible as fireflies on a blade
of grass in pre-dusk blue of day. The Stranger
who should be welcome in your home
for the stranger might also be god.
“It's beautiful,” Michael replied, “but I still, sorry, think it's not quite right for what I need. I think I have to give some proper thought to the amount of text and not be wasting your time until I really know that. my feeling is that a whole sonnet - unbroken sequence of 14 lines - is simply too long. But I think once I'm clear as to the number of sections and their basic length we could properly sort this out - and that will become clearer only when I get something of the actual sequence from Andy. Could you possibly bear with me till then? I totally understand you're going to get snowed under by other things - but don't want to keep sending things back like this any more. it's really not fair on you! As soon as I get something from him, I'll work on it - and be in touch.”
But even before he got the science back from Andrew, he had realized he wanted the work to unfold in 6 sections, which would grow in length according to the Fibonacci series. “This means,” he explained, “1, 1, 2, 3, 5, 8 in terms of length in minutes, adding to a total of 20. I'm wondering if you'd be willing to think in these terms in terms of lines, i.e. one line for section 1, building to 8 in section 6. I'm wondering too, as there will be so much musical repetition, that to tie this in, the poetry repeats patterns of words in one way or another...We talked of the first section emerging again with the full 40 voices, and I could certainly think the first line, or an echo of it, appearing again. I KNOW this is a constraint (and is abstract and does not confront the concrete subject of the words!) but I think this will give me the right amount of words and in the right divisions that I'm looking for - and tie them in structurally (and I hope not be so different than writing a 7+7 sonnet). “I know we're heading into the tunnel of term. Please don't feel obliged to do now! But if that one starting line came, it would help me I think to get going.”
It was now 30th September. I felt we were getting close at last to what was needed. Michael clearly thought much more mathematically than me but poetry is all about very precise sounds and once you get technical you are into the home straight.
“Do you mean,” I emailed back, “1 line (to recur as a refrain) followed by 1 more new line; then 2 new lines; then 3 new lines followed by 5 new lines (which wd probably include the refrain line or others); then 8 new lines (which would probably include the refrain line and others)? That would mean, from where I am, two verses of eight lines each ie 16 lines in all.”
“Yes exactly,” he came back, “The idea of a refrain (or varied refrain): two verses of 8 lines could be fine to be the over-arching way to think about it (symmetrical etc). But it would be great if each of the units, 1, 1, 2, 3, and 5 could also make sense, be 'complete' (enough) as units too. Could you imagine the first line refrain, or perhaps better a fragment of it, coming in the 1, 2, 3 line segments as well as the 5 and 8, (perhaps each time a little more, a word more, so slowly growing).These patterns would map excellently into music...”
He was also on the trail of the allele. “Andy confirmed that the study he is doing is, as he put it, 'to establish whether certain particular alleles are more common in choral singers than in non-musicians'. To point to an allele for musicality. He laid out for my layman's mind that an allele is a 'specific form of a gene." Michael had looked up allele on the web and what he found was, he said “rather useful.”
"Usually alleles are sequences that code for a gene, but sometimes the term is used to refer to a non-gene sequence. An individual's genotype for that gene is the set of alleles it happens to possess. In a diploid organism, one that has two copies of each chromosome, two alleles make up the individual's genotype.
An example is the gene for blossom color in many species of flower — a single gene controls the color of the petals, but there may be several different versions (or alleles) of the gene. One version might result in red petals, while another might result in white petals. The resulting color of an individual flower will depend on which two alleles it possesses for the gene and how the two interact.
An allele is an alternative form of a gene (in diploids, one member of a pair) that is located at a specific position on a specific chromosome. Diploid organisms, for example, humans, have paired homologous chromosomes in their somatic cells, and these contain two copies of each gene.”
This I felt was the kind of thing that inspires. We had something in common - we both it seemed could react to an idea, a chain of responses with the precision and technicalities which science is all about - but so, when you get down to them, are poetry and music.
“Sitting here close to midnight,” he said, “I think I still need to get around my head that Andy’s study is not (simplistically) looking for a 'gene' for music but rather for a 'specific form of a gene'. At any rate to return to the main point: alleles - and the 'mystery' that the tiniest of differences (in the sequence) has these major ramifications - are the thing.”
But I realized I had got my maths wrong. “I can't count, clearly,” I wrote on 5th October. “Your original Fibonacci thing adds up to 20 lines, not 16! So though I might look for a break, for symmetry, after five lines, the whole must be an organic 20 on this basis, yes? -
NEW STRUCTURE 5.10.09
line 1 - one line (complete in itself)
line 2 - one line (complete in itself
lines 3 and 4 - two lines (complete unit of two)
lines 5, 6, 7 - three lines (complete unit of three)
lines 8 9 10 11 12 - five lines (complete unit of five)
lines 13-20 - eight lines (complete in themselves somehow)
With a fragment of Line 1 turning up in the other segments, slowly growing if possible.”
“I guess I can't count either!” he wrote back. “Though in fact the 20 total was deliberate, as this was my original intention for length, and so the Fibonacci fitted well into this. So yes, 20 - but with repetitions of the opening line or part, and each section being complete (making sense)
in itself (if building up to 20 lines) - is that okay?”
I had a new version for him now Twenty lines made the structure very clear, five stanzas of four liners. I had to bring back words and patterns of words, very precisely, with the kind of repetition I wouldn’t normally choose to put in a poem, but which he needed. And I had allowed my obsession with migrating to creep into the images I brought to the table.
DRAFT II MICHAEL’S POEM 6/10/09
The mystery of tiniest differences, invisible, unknown.
Flight of the tiniest humming-birds, in sequence.
Red and orange wings above the sea
in the unknown mystery: migrating.
Fireflies, invisible, occult as Kabbalah,
sleeping in the mysteries of day.
Tiniest wings folded over lightning.
Plankton, invisible in the pelagic zone,
till they become a mystery of the moon:
the tiniest shooting stars, unknown
phosphorescent differences, white
sparks in black water, racing behind the skiff.
The mystery of the tiniest differences.
A barcode occult as Kabbalah. Alleles,
shadows in the mirror of the self, invisible.
Tiniest freckles on a silver sea when dawn
scatters autumn cloud. The unknown Other,
embedded in the sequence and revealed in song.
A stranger who should be welcome in your home,
for the Stranger might also be god.
We were both enmeshed in other lives now, the lives of term, teaching and writing. I was up and down from Cambridge, he was up and down to Southampton.
“Ruth looking at this on the train I think it's really beautiful and just perfect now for what I need. Thank you! And for redoing and redoing. I love the way you've embedded the Fibonacci in the 5 times 4 line structure. All the repetitions and half repetitions are just right. Hope you feel it stands as a poem in itst own right as well as words for music. Love that you keep the final sentiment from your final poem. Want to ask you about god with a small g as opposed to god with a big one and god with an a before it!.. Hope to speak later in the week.”
But now we had to refine things.“Yes I think it works, in the way a poem works. I too feel god with small g would be better - what do you think?” I sent Andrew the new text too. “ The genome sequence has mutated (of course, what else would it do?) into this. Michael wanted something much more mathematically patterned to fit in with what he wanted and you wanted, so I did him an extra one of his own, using some of the language and images from the sequence. I suggested as far as I could understand it that alleles were the things of differences, and he'd like to call the poem Allele. We are still tinkering with tiny details, but he is happy with this.”
This was the point where the most technically fascinating part of the collaboration began, with each of us refining details like film editors on the cutting-room floor. “I've taken a closer reading of the poem,” wrote Michael, “thinking hard about the music. I've taken the liberty of tweaking a few tiny things. I think you will see this as disturbing your poetic metre, in fact I'm sure you will!, but it will allow a better musical metre and flow:
1) i've removed a few definite articles, especially the first. Without it the music can just begin straight in - with it I have to set this word as some kind of upbeat - and I can only say this is something I really would like to avoid as it will at the very start stop up the flow.
2) I suspect too you will think without these articles it starts to sound somehow 'grander' - yet instead I think it simultaneously brings the meaning closer to the reader/listener.
3) I've also removed a few plurals - again it seems to me the plurals make the words more distanced, the singular, more personal - again i have no doubt it's what you wanted! But if it is singular and personal, I feel it brings the subject closer to a listener and to the singers - they will be able then sing 'to' the allele and not just about it.- i think this will result in more expressive music and singing.
4) I think the title of the the piece could very well and strongly be Allele. If it is, it supports still more the singularisation.
5) I've been very cheeky and changed your ending slightly. Repeating 'Stranger who...'will allow again a big expressive build; the 'explanatory' 'for' again I think 'tells' rather than evokes and so distances the music. “I know it's very cheeky of me to do this. But I hope you'll understand why - it will allow the music to flow fully out of your beautiful words, and at no time be blocked by them.
“PS I can see there is now an inconsistency of plural and singular in first stanza. I don't know if this is a problem or not... ...if you think it is - could I suggest then the opening remains plural but your penultimate stanza opening line is singular (another tiny difference, as also your addition of the word 'the' before it)… I'll stop!
DRAFT III ALLELE, Michael’s version 6/10/09
Mystery of tiniest difference, invisible, unknown.
Flight of the tiniest humming-birds, in sequence.
Red and orange wings above the sea
in the unknown mystery: migrating.
Fireflies, invisible, occult as Kabbalah,
sleeping in the mysteries of day.
Tiniest wings folded over lightning.
Plankton, invisible in the pelagic zone,
till they become a mystery of the moon:
tiniest shooting stars, unknown
phosphorescent differences, white
sparks in black water, racing behind the skiff.
Mystery of the tiniest difference.
A barcode occult as Kabbalah. Allele,
shadow in the mirror of the self, invisible.
Tiniest freckle on a silver sea when dawn
scatters autumn cloud. The unknown Other,
embedded in the sequence and revealed in song.
Stranger who should be welcome in your home,
stranger who might also be god.
“Singular, not plural,” Michael said. “Not ‘about’ alleles - but somehow closer to them, almost being addressesd and so more expressive,. Allele – will be repeated…!” We were now done to the tiny syllables and pauses which make all the difference to sound and meaning in poetry and music.
“I can’t bear the last line without the ‘for’, I said, sending a new version. “And I had to keep one or two "the's". How is this? Maybe you are right about God.”
DRAFT IV ALLELE Ruth version 7/10/09
Mystery of tiniest difference, invisible, unknown.
Flight of the tiniest humming-birds, in sequence:
the mystery of migrating, red and orange wings
above the Gulf of Mexico.
Fireflies, invisible, occult as Kabbalah,
tiniest wings folded over lightning glow,
sleeping in the mysteries of day.
Plankton, invisible in the pelagic zone
till they become a mystery of the moon,
tiniest shooting stars, unknown
phosphorescent differences, white
sparks in black water racing behind the skiff.
Mystery of the tiniest difference,
barcode occult as Kabbalah: allele,
shadow in the mirror of the self, invisible.
Tiniest freckle on a silver sea when dawn
scatters autumn cloud. The Other, the unknown,
embedded in the sequence and revealed in song.
The Stranger who should be welcome in your home
for Stranger might also be God.
“Ruth thank you,” he wrote. But -
“1) oh dear - I really did think the first verse was perfect as was -'unknown' was repeated from line 1 in line 4, the rhythm led to music and I didn't think it 'told' too much at all. Mentioning the Gulf of Mexico for me pushes it in a completely different (and too localised) direction as though the main subject is migration of specific humming birds - and not alleles! and feels all wrong musically. Could you possibly be happy to turn it back exactly to where it was which felt just perfectly balanced ('migrating' as it was placed being both about the birds, and somehow about the genetic differences too) and right for me? I really hope so.
2) the inversion of lines in verse 2 feels really good.
3) I'm afraid of God with a big G! - I didn't mean to imply changing it;I was just interested to talk about it - but what if you simply had stranger and god both lower case? I guess I'm concerned it becomes strangely conventionally religious -which i'm sure you don't mean at all - with the big G. What do you think?
4) Leading on, if only Other then has a big O, perhaps that rather sticks out - does it mean anything with a small 'o'?
5) I understand about keeping the last line 'for' as is...that's fine. I've sent you another version keeping your tweaks and changes but going back to the substance of verse 1. Could we be there?!”
DRAFT V Michael version 7/10 ALLELE
Mystery of tiniest difference, invisible, unknown.
Flight of the tiniest humming-birds, in sequence.
Red and orange wings above the sea
in the unknown mystery: migrating.
Fireflies, invisible, occult as Kabbalah,
tiniest wings folded over lightning glow,
sleeping in the mysteries of day.
Plankton, invisible in the pelagic zone,
till they become a mystery of the moon,
tiniest shooting stars, unknown
phosphorescent differences, white
sparks in black water, racing behind the skiff.
Mystery of the tiniest difference.
A barcode occult as Kabbalah: allele,
shadow in the mirror of the self, invisible.
Tiniest freckle on a silver sea when dawn
scatters autumn cloud. The Other, the unknown,
embedded in the sequence and revealed in song.
The stranger who should be welcome in your home,
for stranger might also be god.
“I agree about capital letters and god!” I replied. “But we can’t have “unknown mystery", it's a tautology. How about this?
DRAFT VI Ruth version 8/10 ALLELE
Mystery of tiniest difference, invisible, unknown.
Flight of the tiniest humming-birds, in sequence.
The mystery of migrating, crimson
wings above an unknown sea.
Invisible fireflies, sleeping, occult as Kabbalah,
tiniest wings folded over lightning
in know, bright mysteries of day.
Plankton, invisible in the pelagic zone
till they become a mystery of the moon:
tiniest shooting stars in unknown sequence,
white phosphorerescent sparks in spray
of black water, racing behind the skiff.
Mystery of the tiniest difference. Allele,
invisible shadow in the mirror of the self,
occult as Kabbalah. Tiniest freckle visible
on sea, when dawn scatters autumn cloud.
The Other, the unknown. Embedded in
the tinest difference and revealed in song.
A stranger who should be welcome in your home
for stranger might also be god.
“I'm sure if you start changing my notes,” responded Michael, “I'd protest...! I'm learning much about writing poetry... But I've changed a bit:
1) the phrase 'the mystery of migration' feels stiff for music - I still really liked the migration at the end, and also 'mystery' in line 4 rather than line 3; I've left mystery there without an adjective at all. Is it too bare? Perhaps it disturbs your rhythm - but it feels fine to me.
2) I much preferred fireflies before invisible - as it was - again musically it's more flexible.
3) I love all the new 'sequences' (and crimson).
4) I've been very cheeky and added unknown before sea in verse 4 - does this damage your rhythm?
5) I miss the way the last verse is run straight into as it did before - but see why you've done it. And now you've brought in “tiniest difference” again there, which is lovely, I wouldn't want to disturb that.
6) I think 'the stranger' is stronger than 'a stranger- are you prepared to reinstate?
I feel I should never had set this running at all now - I'm sorry.”
DRAFT VII ALLELE Michael version 8/10
Mystery of tiniest difference, invisible, unknown.
Flight of the tiniest humming-birds, in sequence.
Crimson wings above an unknown sea,
in the mystery: migrating.
Fireflies, invisible, occult as Kabbalah,
tiniest wings folded over lightning glow,
sleeping, in the bright mysteries of day.
Plankton, invisible in the pelagic zone,
till they become a mystery of moon:
tiniest shooting stars in unknown sequence,
white phosphorescent sparks in spray
of black water, racing behind the skiff.
Mystery of the tiniest difference. Allele,
invisible, shadow in the mirror of the self,
occult as Kabbalah: Tiniest freckle visible
on unknown sea, when dawn scatters autumn cloud.
The Other, the unknown. Embedded in
the tiniest difference and revealed in song.
The stranger who should be welcome in your home
for stranger might also be god.
This was an exhilarating finale. We really were down to tiniest differences and their mystery. It was exciting to work with someone so generous but also so demanding - who was as concerned about tiny inflexions of word and syllable as me but in a complementary way. And I didn’t want that colon. I felt it was too “telling”.
“You can have “migrating” or “migration”,” I wrote, “whichever you like but I'm afraid "The mystery of" has to stand. I've imported "wind" for you to play with and brought it back at the end.” I threw out his “unknown” before the sea in verse 4. Does this damage your rhythm he had asked. No, but it damaged sense - why was the sea unknown? Words to have non-musical reasons of sense too. The point of this phrase was compare the allele to a freckle. "Unknown" didn’t help that comparison. I imported “crimson” instead. And he was absolutely right to set this running. “Every time it gets tighter.”
DRAFT VIII ALLELE Ruth version Friday October 9th
Mystery of tiniest difference, invisible, unknown.
Flight of the tiniest humming-birds, in sequence.
Crimson wings above an unknown sea
in autumn wind. The mystery of migrating.
Fireflies, invisible, occult as Kabbalah,
tiniest wings folded on lightning glow,
sleeping through bright mysteries of day.
Plankton, invisible in the pelagic zone
till they become a mystery of moon,
sequence of tiniest shooting stars, unknown
phosphorescent sparks in white spray
on black water, racing behind the skiff.
Mystery of the tiniest difference. Allele,
occult as Kabbalah, shadow in the mirror
of the self. Tiniest freckle visible at dawn
on autumn sea, when wind scatters crimson cloud.
The Other, the unknown. Embedded in
the tiniest difference and revealed in song.
The stranger who should be welcome in your home
for stranger may also be god.
“Well yes it does become tighter,” he wrote back, “and now it's beautifully, perfectly taut. I love it - and hope you'll be there to tighten my music when the time comes! Hust one question: now 'autumn' has entered the picture, I understand its meaning in relation to humming birds' migration, but would find it harder to explain when attached to the sea with the freckle! BUT I AM NOT SUGGESTING ANY CHANGES!!! And indeed I love the very fact that the same beautiful adjective is attached to two different nouns: that, and the many other similar word changes will match/parallel, I hope, the music
btw - one other thing just to say - putting 'the mystery of migrating' at the end of the first stanza suddenly makes it work perfectly for me - I'm at a loss to say why! So we're done - and thanks again for all this exchange - now I DO feel it was really worth setting running! - I loved it.”
“Yes I hoped you’d like the repeat of ‘autumn’, I said. “I suppose underlyingly we are talking about genes in people which take time to find their (eg musical) expression; and that takes time - and autumn is harvest.” So that was our harvest, eight drafts over two months. But then Michael’s real work began.
I was overwhelmed when I first heard it as work in progress on the piano. I was overjoyed with the plainsong feel, the way it evoked for me Tallis’s Spem in Alium. And even more so when I heard the choir sing it so beautifully, three times, the following summer, in the excitement of hearing those words we had worked so hard on spiralling up and intermingling in forty different voices. All those tiny differences and syllables had become the basis for a most wonderful, emotionally compelling and complex structure. I marvelled at the mystery of how words and music can work with science to create new forms.
Or perhaps I should say how science can mutate and evolve a new life through words and music.
Ruth Padel
